Home Up Feedback Contents Search Sell your Prod. Meet us News           

Home • Up





+32 1658 9045


0032 (0)16 41 44 07

+32 1650 9045


Av. de l' Armιe 68

B-1040 Brussels



tel 01 43 25 01 50

fax01 43 25 01 60

9, rue Lagrange

75005 Paris


tel 02 36 00 65 93

fax 02 36 00 65 94

20135 Milano


tel +32 1658 9045

fax +32 1650 9045


Tel 058 710 33 44

Fax 00 32 16 50 90 45

ul. Grunwaldzka 88A/2

81-771 Sopot


tel +81 78 386 0860

fax +81 78 306 0296


Chuo-ku, Kobe



Canada Montreal

Českα republika Praha


Finland Helsset

Ελλάς Αθήνα

Magyarorszαg Budapest

Ireland Dublin



Norge Oslo

Polska Warszawa

Sverige Stockholm

Schweiz Zόri

US New York

Other Countries
0032 (0)16 41 44 07






B0001 Fluorescein-M13-Universal Primer 5’-F-d (CGACGTTGTAAAACGACGGCCAGT) 1 56 €
B0002 Fluorescein-M13-Reverse Primer 5-’F-d (CAGGAAACAGCTATGAC)-3’ 1 56 €
B0003 Fluorescein-M13-Sequencing Primer 5’-d (CGCCAGGGTTTTCCCAGTCACGAC)-3’ 1 56 €
B0010 M13/pUC Sequencing Primer (-20) 5’-d (GTAAAACGACGGCCAGT )-3’ 1 56 €
B0011 M13/pUC Sequencing Primer (-40) 5’-d (GTTTTCCCAGTCACGAC )-3’ 1 56 €
B0012 M13/pUC Sequencing Primer (-47) 5’-d (CGCCAGGGTTTTCCCAGTCACGAC)-3’ 1 56 €
B0013 M13/pUC Reverse Sequencing 5’-d (AACAGCTATGACCATG )-3’ 1 56 €
B0014 M13/pUC Reverse Sequencing Primer (-48) 5’-d (AGCGGATAACAATTTCACACAGGA)-3’ 1 56 €
B0016 RD20 Primer 5’-d (CGACGGCCAGTGAATTCCCC)-3’ 1 56 €
B0018 pBR322 EcoR I Site Primer (clockwise) 5’d (GTATCACGAGGCCCT)-3’ 1 56 €
B0019 pBR322 EcoR I Site Primer (clockwise) 5’-d (CCTATAAAAATAGGCGTATCACGAGGCCCT)3' 1 56 €
B0020 pBR322 EcoR I Site Primer (counter-clockwise) 5’-d (GATAAGCTGTCAAAC)-3’ 1 56 €
B0021 pBR322 EcoR I Site Primer (counter-clockwise) 5’-d (TTAAAGCTTATCGATGATAAGCTGTCAAAC)-3’ 1 56 €
B0022 pBR322 BamH I Site Primer   (clockwise) 5’-d (CACTATCGACTACGCGATCA)-3’ 1 56 €
B0023 pBR322 BamH I Site Primer   (clockwise) 5’-d (TACTTGGAGCCACTATCGACTACGCGATCA)-3’ 1 56 €
B0024 pBR322 BamH I Site Primer  (counter clockwise) 5’-d (ATGCGTCCGGCGTAGA)-3’ 1 56 €
B0024 pBR322 BamH I Site Primer  (counter clockwise) 5’-d (ATGCGTCCGGCGTAGA)-3’ 1 56 €
B0025 pBR322 Hind III  Site Primer     (clockwise) 5’-d (GACAGCTTATCATCG)-3’ 1 56 €
B0026 pBR322 Hind III  Site Primer    (clockwise) 5’-d (AGAATTCTCATGTTTGACAGCTT ATCATCG)-3’ 1 56 €
B0027 pBR322 Hind III  Site Primer  (counter clockwise) 5’-d (GCAATTTAACTGTGAT)-3’ 1 56 €
B0028 pBR322 Hind III  Site Primer  (counter clockwise) 5’-d (GCCTGACTGCGTTAGCAATTTAACTGTGAT)-3’ 1 56 €
B0029 pBR322 Pst I Site Primer (clockwise) 5’-d (GCTAGAGTAAGTAGTT)-3’ 1 56 €
B0030 pBR322 Pst I   Site Primer            (clockwise) 5’-d (ATTGTTGCCGGGAAGCTAGAGTAAGTAGTT)-3’ 1 56 €
B0031 pBR322 Pst I  Site Primer            (counter clockwise) 5’-d (AACGACGAGCGTGAC)-3’ 1 56 €
B0032 pBR322 Pst I  Site Primer            (counter clockwise) 5’-d (AATGAAGCCATACCAAACGACGAGCGTGAC)-3’ 1 56 €
B0033 pBR322 Sal I   Site Primer            (clockwise) 5’-d (ATGCAGGAGTCGCAT)-3’ 1 56 €
B0034 pBR322 Sal I   Site Primer             (clockwise) 5’-d (CTGGGCTGCTTCCTAATGCAGGAG TCGCAT)-3’ 1 56 €
B0035 pBR322 Sal I  Site Primer            (counter clockwise) 5’-d (AGTCATGCCCCGCGC)-3’ 1 56 €
B0036 pBR322 Sal I  Site Primer            (counter clockwise) 5’-d (AAGTGCGGCGACGATAGTCATGCCCCGCGC)-3’ 1 56 €
B0037 pBR322 SspI   Site Primer(clockwise) 5’-d (GGAAATGTTGAATACTC)-3’ 1 56 €
B0038 pBR322 Sty  I  Site Primer            (counter clockwise) 5’-d (GCTGGAGATGGCGGACGC)-3’ 1 56 €
B0039 Lambdagt10 Primer ( forward ) 5’-d (AGCAAGTTCAGCCTGGTTAAG )-3’ 1 56 €
B0040 Lambdagt10 Primer ( reverse ) 5’-d (CTTATGAGTATTTCTTCCAGGGTA )-3’ 1 56 €
B0041 Lambda gt11 Primer( forward ) 5’-d (GGTGGCGACGACTCCTGGAGCCCG)-3’ 1 56 €
B0042 Lambda gt11 Primer ( reverse ) 5’-d(TTGACACCAGACCAACTGGTAATG )-3’ 1 56 €
B0043 Random Primer 5' d (NNNNNN) 3' 1 49 €
B0043-1 Random Primer 5' d (NNNNNNNNNN) 3' 1 52 €
B0043-2 Random Primer 5' d (NNNNNNNNN) 3' 1 52 €
B0044 SP6 Promotor Primer 5’-d (CATACGATTTAGGTGACACTATAG )-3’ 1 56 €
B0045 T7 Pomotor Primer 5’-d (TAATACGACTCACTATAGGGAGA)-3’ 1 56 €
B0046 T3 Promotor Primer 5’-d (ATTAACCCTCACTAAAGGGA)-3’ 1 56 €
B0047 M13 Hybridization Probe Primer 5’-d (CACAATTCCACACAAC)-3’ 1 56 €
B0181 Oligod(T)18      
B0182 Oligod(T)36      
B0183 Oligod(T)36A      
B0184 Oligod(T)36 C      
B0185 Oligod(T)36 G      
B0186 Oligod(T)36 (A/G/C)      
B0187 Oligod(A)18      
B0188 Oligod(C)18      
B0189 Oligod(G)18      
B0190 Biotin-Oligod(T)36      


Copyright © 2002 GENTAUR Molecular Products
Last modified: 05/29/09