Home Up Feedback Contents Search Sell your Prod. Meet us News           

Home • Up





+32 1658 9045


0032 (0)16 41 44 07

+32 1650 9045


Av. de l' Armιe 68

B-1040 Brussels



tel 01 43 25 01 50

fax01 43 25 01 60

9, rue Lagrange

75005 Paris


tel 02 36 00 65 93

fax 02 36 00 65 94

20135 Milano


tel +32 1658 9045

fax +32 1650 9045


Tel 058 710 33 44

Fax 00 32 16 50 90 45

ul. Grunwaldzka 88A/2

81-771 Sopot


tel +81 78 386 0860

fax +81 78 306 0296


Chuo-ku, Kobe



Canada Montreal

Českα republika Praha


Finland Helsset

Ελλάς Αθήνα

Magyarorszαg Budapest

Ireland Dublin



Norge Oslo

Polska Warszawa

Sverige Stockholm

Schweiz Zόri

US New York

Other Countries
0032 (0)16 41 44 07






B0001 Fluorescein-M13-Universal Primer 5’-F-d (CGACGTTGTAAAACGACGGCCAGT) 1 56 €
B0002 Fluorescein-M13-Reverse Primer 5-’F-d (CAGGAAACAGCTATGAC)-3’ 1 56 €
B0003 Fluorescein-M13-Sequencing Primer 5’-d (CGCCAGGGTTTTCCCAGTCACGAC)-3’ 1 56 €
B0010 M13/pUC Sequencing Primer (-20) 5’-d (GTAAAACGACGGCCAGT )-3’ 1 56 €
B0011 M13/pUC Sequencing Primer (-40) 5’-d (GTTTTCCCAGTCACGAC )-3’ 1 56 €
B0012 M13/pUC Sequencing Primer (-47) 5’-d (CGCCAGGGTTTTCCCAGTCACGAC)-3’ 1 56 €
B0013 M13/pUC Reverse Sequencing 5’-d (AACAGCTATGACCATG )-3’ 1 56 €
B0014 M13/pUC Reverse Sequencing Primer (-48) 5’-d (AGCGGATAACAATTTCACACAGGA)-3’ 1 56 €
B0016 RD20 Primer 5’-d (CGACGGCCAGTGAATTCCCC)-3’ 1 56 €
B0018 pBR322 EcoR I Site Primer (clockwise) 5’d (GTATCACGAGGCCCT)-3’ 1 56 €
B0019 pBR322 EcoR I Site Primer (clockwise) 5’-d (CCTATAAAAATAGGCGTATCACGAGGCCCT)3' 1 56 €
B0020 pBR322 EcoR I Site Primer (counter-clockwise) 5’-d (GATAAGCTGTCAAAC)-3’ 1 56 €
B0021 pBR322 EcoR I Site Primer (counter-clockwise) 5’-d (TTAAAGCTTATCGATGATAAGCTGTCAAAC)-3’ 1 56 €
B0022 pBR322 BamH I Site Primer   (clockwise) 5’-d (CACTATCGACTACGCGATCA)-3’ 1 56 €
B0023 pBR322 BamH I Site Primer   (clockwise) 5’-d (TACTTGGAGCCACTATCGACTACGCGATCA)-3’ 1 56 €
B0024 pBR322 BamH I Site Primer  (counter clockwise) 5’-d (ATGCGTCCGGCGTAGA)-3’ 1 56 €
B0024 pBR322 BamH I Site Primer  (counter clockwise) 5’-d (ATGCGTCCGGCGTAGA)-3’ 1 56 €
B0025 pBR322 Hind III  Site Primer     (clockwise) 5’-d (GACAGCTTATCATCG)-3’ 1 56 €
B0026 pBR322 Hind III  Site Primer    (clockwise) 5’-d (AGAATTCTCATGTTTGACAGCTT ATCATCG)-3’ 1 56 €
B0027 pBR322 Hind III  Site Primer  (counter clockwise) 5’-d (GCAATTTAACTGTGAT)-3’ 1 56 €
B0028 pBR322 Hind III  Site Primer  (counter clockwise) 5’-d (GCCTGACTGCGTTAGCAATTTAACTGTGAT)-3’ 1 56 €
B0029 pBR322 Pst I Site Primer (clockwise) 5’-d (GCTAGAGTAAGTAGTT)-3’ 1 56 €
B0030 pBR322 Pst I   Site Primer            (clockwise) 5’-d (ATTGTTGCCGGGAAGCTAGAGTAAGTAGTT)-3’ 1 56 €
B0031 pBR322 Pst I  Site Primer            (counter clockwise) 5’-d (AACGACGAGCGTGAC)-3’ 1 56 €
B0032 pBR322 Pst I  Site Primer            (counter clockwise) 5’-d (AATGAAGCCATACCAAACGACGAGCGTGAC)-3’ 1 56 €
B0033 pBR322 Sal I   Site Primer            (clockwise) 5’-d (ATGCAGGAGTCGCAT)-3’ 1 56 €
B0034 pBR322 Sal I   Site Primer             (clockwise) 5’-d (CTGGGCTGCTTCCTAATGCAGGAG TCGCAT)-3’ 1 56 €
B0035 pBR322 Sal I  Site Primer            (counter clockwise) 5’-d (AGTCATGCCCCGCGC)-3’ 1 56 €
B0036 pBR322 Sal I  Site Primer            (counter clockwise) 5’-d (AAGTGCGGCGACGATAGTCATGCCCCGCGC)-3’ 1 56 €
B0037 pBR322 SspI   Site Primer   (clockwise) 5’-d (GGAAATGTTGAATACTC)-3’ 1 56 €
B0038 pBR322 Sty  I  Site Primer   (counter clockwise) 5’-d (GCTGGAGATGGCGGACGC)-3’ 1 56 €
B0039 Lambdagt10 Primer ( forward ) 5’-d (AGCAAGTTCAGCCTGGTTAAG )-3’ 1 56 €
B0040 Lambdagt10 Primer ( reverse ) 5’-d (CTTATGAGTATTTCTTCCAGGGTA )-3’ 1 56 €
B0041 Lambda gt11 Primer( forward ) 5’-d (GGTGGCGACGACTCCTGGAGCCCG)-3’ 1 56 €
B0042 Lambda gt11 Primer ( reverse ) 5’-d(TTGACACCAGACCAACTGGTAATG )-3’ 1 56 €
B0043 Random Primer 5' d (NNNNNN) 3' 1 49 €
B0043-1 Random Primer 5' d (NNNNNNNNNN) 3' 1 52 €
B0043-2 Random Primer 5' d (NNNNNNNNN) 3' 1 52 €
B0044 SP6 Promotor Primer 5’-d (CATACGATTTAGGTGACACTATAG )-3’ 1 56 €
B0045 T7 Pomotor Primer 5’-d (TAATACGACTCACTATAGGGAGA)-3’ 1 56 €
B0046 T3 Promotor Primer 5’-d (ATTAACCCTCACTAAAGGGA)-3’ 1 56 €
B0047 M13 Hybridization Probe Primer 5’-d (CACAATTCCACACAAC)-3’ 1 56 €



Product number Product Quantity Price
26-3000-01 M13/pUC (-20) 17mer 25 ug 103 €
26-3000-02 M13/pUC Reverse (-24) 16mer 25 ug 103 €
26-3000-03 M13/pUC (-40) 17mer 25 ug 103 €
26-3000-04 M13/pUC Reverse (-48) 24mer 25 ug 103 €
26-3000-05 T7 promoter primer 23mer 25 ug 103 €
26-3000-06 T3 Promoter primer 20mer 25 ug 103 €
26-3000-07 SP6 Promoter primer 24mer 25 ug 103 €
26-3000-08 Lambda gt11 forward primer 24mer 25 ug 103 €
26-3000-09 Lambda gt11 reverse primer 24mer 25 ug 103 €
26-3000-10 Lambda gt10 forward primer 21mer 25 ug 103 €
26-3000-11 Lambda gt10 forward primer 24mer 25 ug 103 €
26-3000-12 SP6 Universal 18mer 25 ug 103 €
26-3000-13 T7 Universal Primer (20 mer) 25 ug 103 €
26-3000-14 T7 Minimal Primer (19 mer) 25 ug 103 €
26-3000-21 T7- Bluescript promoter primer 25 ug 103 €
26-3000-22 T3- Bluescript promoter primer 25 ug 103 €
26-3000-23 T7 Oligo d(T)23 46mer 50 ug 155 €
26-3000-24 T7 Oligo d(T) 23 VM 25 ug  
26-3000-41 SSMN d(T) 23 primer 25 ug  
26-3000-43 SSME Adaptor 25 ug  
26-4000-01 Oligo d(T)16 100 ug 111 €
26-4000-02 Oligo d(T) 18 100 ug 111 €
26-4000-03 Random Hexamers 100 ug 111 €
26-4000-04 Oligo d(T) 12 100 ug 111 €
26-4000-05 Oligo d(T) 12-18 100 ug 111 €
26-4000-06 Random Nonamers 100 ug 111 €
26-4000-07 Random Heptamer Phosphorylated pd(N)7 50 ug 155 €
26-4000-08 Random Octamer Phosphorylated pd(N)8 50 ug 155 €
26-4000-09 Random Nonamer Phosphorylated pd(N)9 50 ug 155 €
26-4000-10 Random Hexamer Phosphorylated pd(N)6 50 ug 155 €
26-4000-11 Random Heptamer 100 ug 111 €
26-4000-12 Random Octamer 100 ug 111 €
26-4000-13 Random 12mers 100 ug 115 €
26-4000-14 Random 24mers 100 ug 115 €
26-4000-15 Random 36mers 100 ug 115 €
26-4000-21 5'-Cy3-Hexamer 25 ug 195 €
26-4000-22 5'-Cy3-Heptamer 25 ug 195 €
26-4000-23 5'-Cy3-Octamer 25 ug 195 €
26-4000-24 5'-Cy3-Nonamer 25 ug 195 €
26-4000-31 5'-Cy5-Hexamer 25 ug 195 €
26-4000-32 5'-Cy5-Heptamer 25 ug 195 €
26-4000-33 5'-Cy5-Octamer 25 ug 195 €
26-4000-34 5'-Cy5-Nonamer 25 ug 195 €
26-4000-41 5'-HEX-Hexamer 25 ug 195 €
26-4000-42 5'-HEX-Heptamer 25 ug 195 €
26-4000-43 5’-HEX-Octamer 25 ug 195 €
26-4000-44 5’-HEX-Nonamer 25 ug 195 €
26-4000-51 5’-FAM-Hexamer 25 ug 195 €
26-4000-52 5’-FAM-Heptamer 25 ug 195 €
26-4000-53 5’-FAM-Octamer 25 ug 195 €
26-4000-54 5’-FAM-Nonamer 25 ug 195 €
26-4000-61 5’-TET-Hexamer 25 ug 195 €
26-4000-62 5’-TET-Heptamer 25 ug 195 €
26-4000-63 5'-TET-Octamer 25 ug 195 €
26-4000-64 5'-TET-Nonamer 25 ug 195 €
26-4000-71 5’-Fl-Hexamer 25 ug 195 €
26-4000-72 5’-Fl-Heptamer 25 ug 195 €
26-4000-73 5’-Fl-Octamer 25 ug 195 €
26-4000-74 5’-Fl-Nonamer 25 ug 195 €
26-4000-81 5’-Dig-Hexamer 25 ug 235 €
26-4000-82 5’-Dig-Heptamer 25 ug 235 €
26-4000-83 5’-Dig-Octamer 25 ug 235 €
26-4000-84 5’-Dig-Nonamer 25 ug 235 €
26-4000-91 5’-NH2C-12 -Hexamer 25 ug 195 €
26-4000-92 5’-NH2C-12 -Heptamer 25 ug 195 €
26-4000-93 5’-NH2C-12 -Octamer 25 ug 195 €
26-4000-94 5’-NH2C-12 -Nonamer 25 ug 195 €
26-4001-01 5'-Biotin Hexamer 25 ug 195 €
26-4001-02 5'-Biotin Heptamer 25 ug 195 €
26-4001-03 5'-Biotin Octamer 25 ug 195 €
26-4001-04 5'-Biotin Nonamer 25 ug 195 €
26-4100-02 5’-C-12 amino-Oligo d(T)12-18 25 ug 195 €
26-4112-02 5'-C-12 amino-Oligo d(T)12 25 ug 195 €
26-4113-02 5’-C-12 amino-Oligo d(T)13 25 ug 195 €
26-4114-02 5’-C-12 amino-Oligo d(T)14 25 ug 195 €
26-4115-02 5’-C-12 amino-Oligo d(T)15 25 ug 195 €
26-4116-02 5’-C-12 amino-Oligo d(T)16 25 ug 195 €
26-4117-02 5’-C-12 amino-Oligo d(T)17 25 ug 195 €
26-4118-02 5’-C-12 amino-Oligo d(T)18 25 ug 195 €
26-4119-02 5’-C-12 amino-Oligo d(T)19 25 ug 195 €
26-4120-02 5’-C-12 amino-Oligo d(T)20 25 ug 195 €
26-4121-02 5’-C-12 amino-Oligo d(T)21 25 ug 195 €
26-4200-02 5'-Alexa-Oligo d(T)12-18 25 ug 195 €
26-4212-02 5'-Alexa-Oligo d(T)12 25 ug 195 €
26-4213-02 5'-Alexa-Oligo d(T)13 25 ug 195 €
26-4214-02 5'-Alexa-Oligo d(T)14 25 ug 195 €
26-4215-02 5'-Alexa-Oligo d(T)15 25 ug 195 €
26-4216-02 5'-Alexa-Oligo d(T)16 25 ug 195 €
26-4217-02 5'-Alexa-Oligo d(T)17 25 ug 195 €
26-4218-02 5'-Alexa-Oligo d(T)18 25 ug 195 €
26-4219-02 5'-Alexa-Oligo d(T)19 25 ug 195 €
26-4220-02 5'-Alexa-Oligo d(T)20 25 ug 195 €
26-4221-02 5'-Alexa-Oligo d(T)21 25 ug 195 €
26-4300-02 5'-Cy3-Oligo d(T)12-18 25 ug 195 €
26-4312-02 5'-Cy3-Oligo d(T)12 25 ug 195 €
26-4313-02 5'-Cy3-Oligo d(T)13 25 ug 195 €
26-4314-02 5'-Cy3-Oligo d(T)14 25 ug 195 €
26-4315-02 5'-Cy3-Oligo d(T)15 25 ug 195 €
26-4316-02 5'-Cy3-Oligo d(T)16 25 ug 195 €
26-4317-02 5'-Cy3-Oligo d(T)17 25 ug 195 €
26-4318-02 5'-Cy3-Oligo d(T)18 25 ug 195 €
26-4319-02 5'-Cy3-Oligo d(T)19 25 ug 195 €
26-4320-02 5'-Cy3-Oligo d(T)20 25 ug 195 €
26-4321-02 5'-Cy3-Oligo d(T)21 25 ug 195 €
26-4400-02 5'-Cy5-Oligo d(T)12-18 25 ug 195 €
26-4412-02 5'-Cy5-Oligo d(T)12 25 ug 195 €
26-4413-02 5'-Cy5-Oligo d(T)13 25 ug 195 €
26-4414-02 5'-Cy5-Oligo d(T)14 25 ug 195 €
26-4415-02 5'-Cy5-Oligo d(T)15 25 ug 195 €
26-4416-02 5'-Cy5-Oligo d(T)16 25 ug 195 €
26-4417-02 5'-Cy5-Oligo d(T)17 25 ug 195 €
26-4419-02 5'-Cy5-Oligo d(T)19 25 ug 195 €
26-4420-02 5'-Cy5-Oligo d(T)20 25 ug 195 €
26-4421-02 5'-Cy5-Oligo d(T)21 25 ug 195 €
26-4500-02 5'-Dig-Oligo d(T)12-18 25 ug 195 €
26-4512-02 5'-Dig-Oligo d(T)12 25 ug 235 €
26-4513-02 5'-Dig-Oligo d(T)13 25 ug 235 €
26-4514-02 5'-Dig-Oligo d(T)14 25 ug 235 €
26-4515-02 5'-Dig-Oligo d(T)15 25 ug 235 €
26-4516-02 5'-Dig-Oligo d(T)16 25 ug 235 €
26-4517-02 5'-Dig-Oligo d(T)17 25 ug 235 €
26-4518-02 5'-Dig-Oligo d(T)18 25 ug 235 €
26-4519-02 5'-Dig-Oligo d(T)19 25 ug 235 €
26-4520-02 5'-Dig-Oligo d(T)20 25 ug 235 €
26-4521-02 5'-Dig-Oligo d(T)21 25 ug 235 €
26-4600-02 5'-FAM-Oligo d(T)12-18 25 ug 195 €
26-4612-02 5'-FAM-Oligo d(T)12 25 ug 195 €
26-4613-02 5'-FAM-Oligo d(T)13 25 ug 195 €
26-4614-02 5'-FAM-Oligo d(T)14 25 ug 195 €
26-4615-02 5'-FAM-Oligo d(T)15 25 ug 195 €
26-4616-02 5'-FAM-Oligo d(T)16 25 ug 195 €
26-4617-02 5'-FAM-Oligo d(T)17 25 ug 195 €
26-4618-02 5'-FAM-Oligo d(T)18 25 ug 195 €
26-4619-02 5'-FAM-Oligo d(T)19 25 ug 195 €
26-4620-02 5'-FAM-Oligo d(T)20 25 ug 195 €
26-4621-02 5'-FAM-Oligo d(T)21 25 ug 195 €
26-4700-02 5'-Fl-Oligo d(T)12-18 25 ug 195 €
26-4712-02 5'-Fl-Oligo d(T)12 25 ug 195 €
26-4713-02 5'-Fl-Oligo d(T)13 25 ug 195 €
26-4714-02 5'-Fl-Oligo d(T)14 25 ug 195 €
26-4715-02 5'-Fl-Oligo d(T)15 25 ug 195 €
26-4716-02 5'-Fl-Oligo d(T)16 25 ug 195 €
26-4717-02 5'-Fl-Oligo d(T)17 25 ug 195 €
26-4718-02 5'-Fl-Oligo d(T)18 25 ug 195 €
26-4719-02 5'-Fl-Oligo d(T)19 25 ug 195 €
26-4720-02 5'-Fl-Oligo d(T)20 25 ug 195 €
26-4721-02 5'-Fl-Oligo d(T)21 25 ug 195 €
26-4800-02 5'-HEX-Oligo d(T)12-18 25 ug 195 €
26-4812-02 5'-HEX-Oligo d(T)12 25 ug 195 €
26-4813-02 5'-HEX-Oligo d(T)13 25 ug 195 €
26-4814-02 5'-HEX-Oligo d(T)14 25 ug 195 €
26-4815-02 5'-HEX-Oligo d(T)15 25 ug 195 €
26-4816-02 5'-HEX-Oligo d(T)16 25 ug 195 €
26-4817-02 5'-HEX-Oligo d(T)17 25 ug 195 €
26-4818-02 5'-HEX-Oligo d(T)18 25 ug 195 €
26-4819-02 5'-HEX-Oligo d(T)19 25 ug 195 €
26-4820-02 5'-HEX-Oligo d(T)20 25 ug 195 €
26-4821-02 5'-HEX-Oligo d(T)21 25 ug 195 €
26-4900-02 5'-TET-Oligo d(T)12-18 25 ug 195 €
26-4912-02 5'-TET-Oligo d(T)12 25 ug 195 €
26-4913-02 5'-TET-Oligo d(T)13 25 ug 195 €
26-4914-02 5'-TET-Oligo d(T)14 25 ug 195 €
26-4915-02 5'-TET-Oligo d(T)15 25 ug 195 €
26-4916-02 5'-TET-Oligo d(T)16 25 ug 195 €
26-4917-02 5'-TET-Oligo d(T)17 25 ug 195 €
26-4918-02 5'-TET-Oligo d(T)18 25 ug 195 €
26-4919-02 5'-TET-Oligo d(T)19 25 ug 195 €
26-4920-02 5'-TET-Oligo d(T)20 25 ug 195 €
26-4921-02 5'-TET-Oligo d(T)21 25 ug 195 €
26-7XXX-10 Linkmer; 10nmoles 10 nmoles 135 €
45-4450-08 (AGAT)8 MB-HEX 25 ug 215 €


Copyright © 2002 GENTAUR Molecular Products
Last modified: 05/29/09